Does Transcription Require A Template Dna

DNA Template

Transcribe the DNA templates with an SP6-Scribe Standard RNA IVT Kit (CELLSCRIPT, Madison, WI) in a 10-μL reaction book.

From: Methods in Enzymology , 2015

RNA Polymerases

Hyone-Myong Eun , in Enzymology Primer for Recombinant Deoxyribonucleic acid Technology, 1996

(i) Templates for cistron distension.

Deoxyribonucleic acid templates provided with a functional double-stranded promoter(s) can be readily obtained by PCR using bracketing primers containing T7 or SP6 (or T3) promoter sequences at the v′ termini ( 74, 75). When starting with an RNA, it tin be converted first to cDNA using a RTase (AMV or MoLV) and a T7-promoter primer. The Deoxyribonucleic acid templates are then transcribed by T7 RNA Political leader into multiple copy RNAs which are used by RTase to generate new Deoxyribonucleic acid templates. The combined use of RTase and T7 RNA Political leader in a new gene distension technique, called "3SR" (87) or "NASBA" (90), leads to self-sustained exponential replication of the target sequence nether isothermal conditions.

Read full affiliate

URL:

https://world wide web.sciencedirect.com/science/article/pii/B9780122437403500107

Biological science/DNA

T. Caragine , ... Z.M. Budimlija , in Encyclopedia of Forensic Sciences (2d Edition), 2013

Other Example Examples

LT-DNA testing has been used in electric current casework, cold cases, and mail conviction testing, and in a wide diversity of case types including homicides, assaults/sexual assaults, property crimes, arsons, hate crimes, missing persons investigations, and the identification of human remains. LT-DNA profiles accept been generated from many types of handled show including items that accept been handled extensively or briefly by an individual(southward). These items include cars, airbags, doorknobs, windowsills, tools, jewelry, keys, lighters, matches, letters, envelopes, pens, sides of bottles, weapons, and shrapnel from explosive devices. Fingerprints (both fresh and archived) accept also yielded profiles. Moreover, foreign Deoxyribonucleic acid has been identified on ligatures such as ropes, cords, and tape, equally well equally on clothing. The exact location where the assailant came in contact with the vesture is helpful to target testing.

Although the main application of LT-Deoxyribonucleic acid testing in criminal casework involves items that were potentially handled or touched, it has also been used on old, degraded, or otherwise compromised body fluid samples. An example of a case where LT-Deoxyribonucleic acid testing was washed on one such sample involved the alleged sexual assault of a woman in New York City. In 2005, a woman went out drinking with friends, later separated from her friends and met a group of men. She left with one of the men looking for a party. During that time, she allegedly was raped. When she reunited with her friends, she had a physical atmospherics with ane of them, but the fight was stopped when she alleged that she was previously sexually assaulted.

A rape kit was taken, which was negative for semen, just there were bite marks found on the woman'south arm and shoulder; based largely on the testimony of the woman, the accused man was convicted of sexual assault and sentenced to 20 years in prison. He nonetheless maintained his innocence and requested exam of the swabs from the bite marking. LT-DNA testing revealed only female DNA and the profile generated was consistent with that of the woman's friend. The woman after confessed that the sexual assault never occurred, and the conviction was overturned in 2010.

Read full chapter

URL:

https://world wide web.sciencedirect.com/science/commodity/pii/B9780123821652000453

Laboratory Methods in Enzymology: Dna

Kirstie Canene-Adams , in Methods in Enzymology, 2013

iii Materials

Template DNA

Primers

dNTPs (100 mM each dATP, dCTP, dGTP, dTTP)

Thermostable DNA polymerase (eastward.g., Taq polymerase or a loftier fidelity enzyme)

10× PCR buffer

Tris base

Hydrochloric acid (HCl)

Ammonium sulfate [(NH_four)_iiAnd then₄]

Tween-20

Magnesium chloride (MgCl₂)

Agarose

50× TAE buffer

Ethidium bromide

six× DNA gel loading dye

Sterile ultra pure h2o

3.i Solutions & buffers

Step 1. 10× PCR buffer

Component	Final concentration	Stock	Amount
Tris–HCl, pH 8.viii	750 mM	i M	vii.5 ml
(NH_four)_twoThen₄	200 mM	1 One thousand	2.0 ml
Tween-20	0.1% (v/5)	10%	100 μl

Add purified water to 10 ml

dNTP mix

Component	Final concentration	Stock	Corporeality
dATP	2.v mM	100 mM	25 μl
dCTP	2.five mM	100 mM	25 μl
dGTP	2.5 mM	100 mM	25 μl
dTTP	2.5 mM	100 mM	25 μl

Add together purified water to 1 ml

25 mM MgCl_two

Dilute 25 μl one M MgCl_ii in 975 μl sterile ultra pure water

Read full chapter

URL:

https://world wide web.sciencedirect.com/science/commodity/pii/B9780124186873000240

Nonradioactive In Situ Hybridization

Brent Thou. Bany , David Thousand. Simmons , in The Guide to Investigation of Mouse Pregnancy, 2014

DNA Template Generation—Alternating PCR-Based Methods

Dna templates for in vitro transcription of your gene of interest can be generated containing T7, T3, or SP6 RNA polymerase-binding sites directly without cloning. This can be done by calculation the RNA polymerase-binding site sequences to the ends of the PCR oligonucleotides ( Figures 2 and 3). This eliminates the cloning steps and prevents the presence of multiple cloning site sequences in the riboprobe.

Care must be taken to generate clean PCR products, and they should ever be sequence verified (due east.1000., using RNA polymerase sequencing oligonucleotides). If the PCR reactions are very "clean" and produce just a unmarried band, they tin be isolated with PCR cleanup kits directly. Alternatively, the correct size amplicons can be gel purified for RNA probe synthesis. The amplicon template preparations can be easily quantified using a Nanodrop spectrophotometer; at to the lowest degree 100 ng are used per in vitro riboprobe transcription.

Read full chapter

URL:

https://www.sciencedirect.com/science/commodity/pii/B9780123944450000503

Biophysical Techniques for Structural Characterization of Macromolecules

J.D. Cossar , C.H. Arrowsmith , in Comprehensive Biophysics, 2012

1.three.3.two Template Dna and PCR Cloning

Template DNA for a specified poly peptide target may be obtained from commercial or other collections of individual cDNA clones, cDNA libraries, chemically synthesized Deoxyribonucleic acid, or genomic Deoxyribonucleic acid (for organisms with few introns or domains encoded by a single exon). cDNA clones are the source of first pick and are produced by contrary transcription from mRNA populations of primary source cells (native tissue). cDNAs may carry sequence variants (to the extent of being defective) or single nucleotide polymorphisms, depending on the source tissue. The process of generating DNA from mRNA may also innovate gratuitous mutations. Therefore, the sequences of cDNA templates should be verified before use.

The ability to produce genes synthetically is at present readily found in the commercial sector and the technology is relatively robust. Due to cost and time constraints, we reserve this strategy for sequences that are non bachelor as cDNA. A synthetic molecule may also exist modified to arrange the preferred codon utilization frequency of the host (Figure 2). Inside the standard 64 codons (triplet DNA sequences corresponding to individual amino acids in the polypeptide), information technology is known that different organisms evidence varying usage where in that location is more than ane codon for a given amino acid (e.g., arginine has half dozen cognate codons, proline has four, cysteine has 2, and methionine 1). Therefore, if a protein is to be expressed in a non-native host, it is possible to match the codon usage of the Deoxyribonucleic acid sequence to that of the host organism. The potential benefit rests on the supposition that presentation of a rare (trivial used) codon in a not-natural place on the mRNA tin atomic number 82 to ribosome stalling and premature termination of polypeptide concatenation elongation. For expression of eukaryotic proteins in bacterial hosts, these factors can often be overcome by co-expression with supplemental tRNAs for the rare codons. ¹⁴ The presence of rare codons is as well considered to introduce pauses in elongation of the nascent polypeptide chain, which may permit contained folding of structural domains. Given the somewhat uncertain do good of codon optimization, we do non recommend this approach on starting time laissez passer, and constructed template DNA is normally prepared to provide the native coding sequence.

Genomic DNA is oftentimes the last resort in cases in which the sequence is unacceptably large for synthesis and is non available as cDNA. Genomic DNA is relatively difficult to use because of the low frequency of the target sequence in the total genome and consequent difficulty in obtaining a clean PCR product. In addition, genomic Deoxyribonucleic acid ofttimes contains introns (noncoding Dna inside the gene of interest), which must be removed during the clone construction procedure. The necessity for multiple manipulations to obtain DNA from genomic source material inevitably increases the gamble of introducing deleterious mutations (deletions or substitutions). Such templates must therefore exist sequence verified before use. Due to high intron frequency, mammalian genomic Dna is not normally considered every bit a template for cloning. Withal, genomic source Deoxyribonucleic acid is routinely and successfully used in our lab as template for proteins from Plasmodium falciparum ¹⁵ and similar organisms.

Once the desired DNA template has been obtained, it is convenient to place it into a cloning vector (plasmid) for the purpose of storage, manipulation (including site-directed mutagenesis), sequencing, and for employ equally a template to subclone specific regions for further processing. This belongings stage is typically conducted in East. coli systems due to their ease of use and general fidelity in reproducing the DNA insert. Many systems are available, including strain DH5α and pBluescript or Top10 series plasmids. To avoid concerns of product toxicity or strong growth rate bias to nonproductive variants, expression of the protein product is minimal or nonexistent in such systems.

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123749208001041

Synthetic Biology and Metabolic Applied science in Plants and Microbes Part B: Metabolism in Plants

Northward. Srividya , ... B.Chiliad. Lange , in Methods in Enzymology, 2016

four.1 Quick Change PCR

4.ane.one Distension of Mutated cDNA Sequence

DNA template (plasmid containing target factor)	5–20 ng
5 × HF Phusion Polymerase Buffer (New England Biolabs)	x.0 μL
5 μM gene-specific primer (forwards)	2.5 μL
five μM gene-specific primer (opposite)	ii.v μL
Dimethyl sulfoxide (DMSO)	1.0 μL
ten 1000K deoxynucleotide mix (dNTPs)	1.0 μL
Phusion Deoxyribonucleic acid polymerase (2.5 U) (New England Biolabs)	1.0 μL
Add together deionized, sterile-filtered water to a concluding volume of 50 μL

PCR weather condition: initial denaturing at 98°C for ane.v min; 20 cycles of 98°C for fifteen southward, 55°C for 30 s, 72°C for 5 min; terminal extension at 72°C for 10 min; chill to 4°C for 15 min.

The original plasmid (containing nonmutated target sequence), which was maintained in a bacterial host strain and is therefore partially methylated, is then digested past adding DpnI (10 U) to the above PCR mixture and incubating the mixture at 37°C for one h. Only amplicons with a mutated target sequence are thus retained and further processed. An aliquot (10 μL) of the reaction is evaluated by agarose gel electrophoresis (Fig. 2). Note that the mutation PCR generates an amplicon of the size of the vector plus insert (not just the target cDNA).

4.ane.2 Transformation of Vector Containing Mutated cDNA into Host Cells

An aliquot (three μL) of the DpnI-digested PCR solution was added to l μL water ice-cold, highly competent XL-1 Blue cells (x⁹/μg transformation efficiency or greater) and the mixture kept on ice for 30 min. To allow entry of the vector, the reaction tube was placed at 42°C for 45 s (estrus shock) and returned to ice for 2 min. LB goop (350 μL) was added and the mixture incubated at 37°C for 1 h. An aliquot of the transformation reaction (fifty–200 μL depending on experience values for transformation efficiency) was spread evenly onto LB-agar plates containing 50 μg/mL kanamycin and maintained at 37°C for sixteen h. Unmarried colonies were picked and grown overnight in culture tubes containing 5 mL liquid LB goop and l μg/mL kanamycin. Plasmids were isolated using a MiniPrep kit (these tin can be purchased from diverse suppliers) and the mutation verified by sequencing using commercial services.

Notes: Although the method above lists Phusion equally a Dna polymerase with proofreading chapters that gives blunt ends, Pfu Turbo (Agilent Technologies) was likewise used successfully, only PCR weather accept to be adjusted. The DpnI enzyme will perform satisfactorily in any Mg^{2 +}-containing Polymerase Buffer.

Read total chapter

URL:

https://www.sciencedirect.com/science/article/pii/S0076687916001257

Natural Production Biosynthesis by Microorganisms and Plants, Part C

Anne Osbourn , ... Eva Wegel , in Methods in Enzymology, 2012

5.1 RNA probe training

DNA templates are synthesized past PCR using primers that start with a T7 or SP6 promoter sequence; linear PCR products are precipitated and resuspended in H ₂O to a concentration of 0.5–1 μg/μL. Transcripts are synthesized using an SP6/T7 Transcription Kit (Roche 10999644001) and tin be labeled with biotin-16-UTP (Roche 11388908910), digoxigenin-11-UTP (Roche 11209256910), or dinitrophenol-11-UTP (PerkinElmer NEL555001EA).

1.

After the DNase I digest in the manufacturer'south protocol, add 2 μL of 200 10001000 EDTA (pH 8.0), ii μL of LiCl (4 M), and 75 μL of ice-common cold EtOH. Mix and precipitate at − 20 °C overnight.

ii.

Centrifuge for 15 min at four °C at 15,000 rpm. Launder with ice-cold lxx% EtOH and spin again.

3.

Resuspend pellet in l μL H_iiO (RNase-free), add 50 μL of fresh, filter-sterilized 200 mG carbonate buffer (pH ten.2, made upwards of 80 mGrand NaHCO_iii + 120 mM Na₂CO₃) and mix.

4.

Incubate at 60 °C for required fourth dimension, which depends on probe length:

$t = \frac{{Fifty}_{i} - L_{f}}{K \times 50_{i} \times {Fifty}_{f}},$

where t, fourth dimension in minutes; 1000, rate constant (= 0.11 Kb/min), L _i, initial length (kb), and L _f, final length (optimal L _f = 0.15 kb).

5.

Cease the reaction. Add 5 μL of acetic acid (10%), ten μL of sodium acetate (three Thou, pH 5.5), 288 μL of EtOH (water ice-common cold) and precipitate for two h to overnight at − 20 °C.

6.

Spin, wash, and dry equally above.

7.

Resuspend pellet in 50 μL TE.

8.

Cheque probe concentration past loading iii μL on a 1% agarose gel.

Read full chapter

URL:

https://world wide web.sciencedirect.com/science/article/pii/B9780124046344000061

Isotope Labeling of Biomolecules - Labeling Methods

Feng Xian , ... Siqi Liu , in Methods in Enzymology, 2015

three.1 Overview

A Dna template for peptide expression is designed with several important elements ( Fig. 1), including a T7 promoter, a ribosome-binding site (RBS), and a coding sequence, which encodes a peptide containing a Northward-terminus constant sequence ^fMGAGR (^fGrand representing formylmethionine), the variable target peptide, and a C-terminus abiding sequence WSHPQFEKGGD. WSHPQFEK is the Strep-tag, a short peptide binding with streptavidin tightly that has dual functions for both the purification and quantification of the expressed peptide. GGD is added to prevent premature truncation of the Strep-tag. As PURE includes T7 RNA polymerase and four ribonucleotides required for RNA transcription, the double-strand DNA template can be added direct into the expression organization without being transcribed into RNA first.

A double-strand Deoxyribonucleic acid template for peptide expression is generated by PCR amplification from synthetic oligonucleotides, which tin be reversely translated from the peptide sequence according to the codon usage of East. coli. The size of constructed oligonucleotides is limited to less than sixty residues, which are cheaper to fix and easier to be of high purity than longer ones. As a outcome, for the target peptides less than nine amino acids, one constructed oligonucleotide is enough; for those between nine to 25 amino acids, two constructed oligonucleotides with a short overlapping sequence (x–xiv nucleotides) are used to set up the double-strand Dna template. For PCR amplification, the forrard primer contains the T7 promoter and RBS, while the contrary primer has sequence encoding C-terminus abiding peptide. When two synthetic oligonucleotides are used for PCR, they are mixed at equal ratio and amplified get-go for five cycles without the forward and contrary primers, and and so farther amplified for 35 cycles with both primers. An example of two synthetic oligonucleotides for the preparation of a target peptide is illustrated in Fig. twoA and the ii-pace PCR procedure is shown in Fig. twoB. The forward and reverse primers are listed in Table 1.

Tabular array i. Design of PCR Primers

Frontward primer (five′–three′)
GAAATTAATACGACTCACTATAGGGTAACTTTAAGAAGGAGATATACCAATGGGTGCGGGTCGT

Reverse primer (5′–three′)
TATTCATTAATCGCCACCTTTTTCAAACTGCGGATGGCTCCA

The underline sequences are overlapping with those in synthetic oligonucleotides.

Read total chapter

URL:

https://www.sciencedirect.com/science/article/pii/S0076687915004176

Good PCR Practices

Ayaz Najafov , Gerta Hoxhaj , in PCR Guru, 2017

Precipitating template DNA by cold ethanol is a good fashion of getting rid of contaminations:

1.: Add 3 volumes of 100% ethanol (that was cooled at −twenty^oC for 0.5–1.0 h; ethanol does not freeze at −20^oC) to 1 volume of DNA solution.
2.: Invert the tube 5–vi times.
3.: Spin the tube at 16,000thou for 5 min.
iv.: Carefully discard the supernatant by using pipette tip.
5.: Add solvent (dH₂O or TE Buffer) to deliquesce the Deoxyribonucleic acid pellet.
6.: Mix by pipetting.
vii.: Requantify the Deoxyribonucleic acid concentration and purity.

Read total chapter

URL:

https://world wide web.sciencedirect.com/science/article/pii/B9780128042311000031

Research on Nitrification and Related Processes, Part A

Annika C. Mosier , Christopher A. Francis , in Methods in Enzymology, 2011

ii.4 PCR screening and gene sequencing

Mixed template DNA and cDNA is PCR amplified with primers targeting betaproteobacterial and archaeal amoA: amoA-1F* (Stephen et al., 1999) or amoA-1F and amoA-2R (Rotthauwe et al., 1997) for β-AOB; Arch-amoAF and Arch-amoAR (Francis et al., 2005) for AOA. Clone libraries of amoA cistron fragments are constructed using a TOPO TA cloning kit (Invitrogen) and individual clones are sequenced. Both nucleic acid and amino acid sequences are subjected to phylogenetic analysis. Sequences are manually aligned with GenBank sequences using MacClade (http://macclade.org) and phylogenetic trees are constructed in ARB (Ludwig et al., 2004).

Read full chapter

URL:

https://www.sciencedirect.com/science/article/pii/B9780123812940000092